-
Berthelsen Horton posted an update 6 months, 1 week ago
PHNs showed lower capacity for evaluating initiatives, tools and support for staff, and staff training.
We critique the importance of weightings and scope of some capacity domains in the ORACLe tool. Despite this, with some minor modifications, we conclude the ORACLe tool can identify capacity strengths and limitations in meso-level PHC organizations. Well-targeted capacity development enables PHC organizations’ strategies to be better informed by evidence, for optimal impact on PHC and population health outcomes.
We critique the importance of weightings and scope of some capacity domains in the ORACLe tool. Despite this, with some minor modifications, we conclude the ORACLe tool can identify capacity strengths and limitations in meso-level PHC organizations. Well-targeted capacity development enables PHC organizations’ strategies to be better informed by evidence, for optimal impact on PHC and population health outcomes.
In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously.
The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected.
The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found.
With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.
With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.
Previous observational studies have highlighted the negative effects of serum hormone levels at the minimum threshold during frozen embryo transfer (FET) cycles. However, still the questions regarding the maximum threshold level, and the highest allowed dosage of hormonal medications remain unresolved. The present study was conducted to determine whether there is any relationship between the serum progesterone and estradiol levels on the day of ET, and live birth rate (LBR) in patients receiving HRT in FET cycles.
In this prospective cohort study, eligible women who were undergoing their first or second FET cycles with the top graded blastocyst stage embryos were included. All patients received the same HRT regimen. FET was scheduled 5 days after administration of the first dosage of progesterone. On the morning of ET, 4-6 h after the last dose of progesterone supplementation, the serum progesterone (P
ng/ml) and estradiol (E
, pg/ml) levels were measured.
Amongst the 258 eligible women that were evaHowever, the results regarding the necessity for the screening of serum E
levels before ET, are still controversial, and further prospective studies are required.
The present study suggests that a serum P4 value at the maximum threshold on the day of FET is associated with reduced LBR following blastocyst transfer. selleck products Therefore, measuring and monitoring of P4 levels during FET cycles might be necessary. However, the results regarding the necessity for the screening of serum E2 levels before ET, are still controversial, and further prospective studies are required.
Both the highly pathogenic avian influenza (HPAI) H5N1 and low pathogenic avian influenza (LPAI) H9N2 viruses have been reported to cross species barriers to infect humans. H5N1 viruses can cause severe damage and are associated with a high mortality rate, but H9N2 viruses do not cause such outcomes. Our purpose was to use proteomics technology to study the differential expression of mitochondrial-related proteins related to H5N1 and H9N2 virus infections.
According to the determined viral infection titer, A549 cells were infected with 1 multiplicity of infection virus, and the mitochondria were extracted after 24h of incubation. The protein from lysed mitochondria was analyzed by the BCA method to determine the protein concentration, as well as SDS-PAGE (preliminary analysis), two-dimensional gel electrophoresis, and mass spectrometry. Differential protein spots were selected, and Western blotting was performed to verify the proteomics results. The identified proteins were subjected to GO analysis for sun the H9N2 group, the differential expression of eight mitochondrial proteins in the H5N1 group led to host T cell activation, antigen presentation, stress response, ATP synthesis and cell apoptosis reduction, leading to higher pathogenicity of H5N1 than H9N2.
Compared with their expression in the H9N2 group, the differential expression of eight mitochondrial proteins in the H5N1 group led to host T cell activation, antigen presentation, stress response, ATP synthesis and cell apoptosis reduction, leading to higher pathogenicity of H5N1 than H9N2.
The Halcyon is a new machine from the Varian company. The purpose of this study was to evaluate the dosimetry of the Halcyon in treatment of bilateral breast cancer with volumetric modulated arc therapy.
On CT images of 10 patients with bilateral breast cancer, four Halcyon plans with different setup fields were generated, and dosimetric comparisons using Bonferroni’s multiple comparisons test were conducted among the four plans. Whole and partial arc plans on the Trilogy and the Halcyon, referred to as T-4arc, T-8arc, H-4arc and H-8arc, were designed. The prescription dose was 50Gy in 2-Gy fractions. All plans were designed with the Eclipse version 15.5 treatment planning system. The dosimetric differences between whole and partial arc plans in the same accelerator were compared using the Mann-Whitney U test. The better Halcyon plan was selected for the further dosimetric comparison of the plan quality and delivery efficiency between the Trilogy and the Halcyon.
Halcyon plans with high-quality megavoltage cone beam CT setup fields increased the D
, D
and V
of the planning target volume (PTV) and the V
and D
of the heart, left ventricle (LV) and lungs compared with other Halcyon setup plans.